Quick Order

Text Size:AAA

Human UBE2E1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human UBE2E1 cDNA Clone Product Information
Gene_bank_ref_id:NM_003341.3
RefSeq ORF Size:572bp
cDNA Description:Full length Clone DNA of Homo sapiens ubiquitin-conjugating enzyme E2E 1 (UBC4/5 homolog, yeast) with N terminal Myc tag.
Gene Synonym:UBCH6, UBE2E1
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Ubiquitin-conjugating enzyme E2E1 (UBE2E1) is a member of the ubiquitin-donjugating enzyme family. UBE2E1 is a protein localized to the nucleus. The modification of proteins with ubiquitin is an importantly step for targeting abnormal or short-lived proteins for degeneration. It has been demonstrated to be released to Sjogrens's syndrome and systemic lupus Erythematosus. Patients with the systemic autoimmune diseases Sjogrens's syndrome and systemic lupus erythematosus often have autoantibodies against the intracellular protein Ro52 that is an E3 ligase dependent on the ubiquitin conjugation enzymes UBE2E1. Ro52 mediates ubiquitination through UBE2D1 in the cytoplasm and through UBE2E1 in the nucleus.

References
  • Nuber U, et al. (1996) Cloning of human ubiquitin-conjugating enzymes UbcH6 and UbcH7 (E2-F1) and characterization of their interaction with E6-AP and RSP5. J Biol Chem. 271(5): 2795-800.
  • Espinosa A, et al. (2008) The autoantigen Ro52 is an E3 ligase resident in the cytoplasm but enters the nucleus upon cellular exposure to nitric oxide. Exp Cell Res. 314(20): 3605-13.
  • Anan T, et al. (1998) Human ubiquitin-protein ligase Nedd4: expression, subcellular localization and selective interaction with ubiquitin-conjugating enzymes. Genes Cells. 3(11): 751-63.
  • Size / Price
    Catalog: HG12003-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"