Quick Order

Text Size:AAA

Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
OXSR1cDNA Clone Product Information
cDNA Size:1584
cDNA Description:ORF Clone of Homo sapiens oxidative-stress responsive 1 DNA.
Gene Synonym:OSR1, KIAA1101, OXSR1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10727-ACG$345
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10727-ACR$345
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10727-ANG$345
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10727-ANR$345
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10727-CF$315
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10727-CH$315
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10727-CM$315
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10727-CY$315
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone)HG10727-M$115
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10727-M-F$315
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10727-M-N$315
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10727-NF$315
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10727-NH$315
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10727-NM$315
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10727-NY$315
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10727-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Oxidative stress-responsive 1 protein (OXSR1), also known as Serine/threonine-protein kinase OSR1, is a member of the Ser/Thr protein kinase family of proteins. OXSR1 regulates downstream kinases in response to environmental stress, and may play a role in regulating the actin cytoskeleton. OXSR1 is a 58 kDa protein of 527 amino acids that is widely expressed in mammalian tissues and cell lines. The amino acid (aa) sequence of the predicted OXSR1 protein is 39% identical to that of human SOK1. Of potential regulators surveyed, endogenous OXSR1 is activated only by osmotic stresses, notably sorbitol and to a lesser extent NaCl. OXSR1 did not increase the activity of coexpressed JNK, nor did it activate three other MAPKs, p38, ERK2, and ERK5. Phosphorylation by OXSR1 modulates the G protein sensitivity of PAK isoforms. The OXSR1 and SPAK are key enzymes in a signalling cascade regulating the activity of Na+/K+/2Cl- co-transporters (NKCCs) in response to osmotic stress. Both kinases have a conserved carboxy-terminal (CCT) domain, which recognizes a unique peptide (Arg-Phe-Xaa-Val) motif. The OXSR1 and SPAK kinases specifically recognize their upstream activators and downstream substrates.

Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items