Quick Order

Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DYRK3cDNA Clone Product Information
cDNA Size:1767
cDNA Description:ORF Clone of Homo sapiens dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 DNA.
Gene Synonym:RED, REDK, DYRK5, hYAK3-2, DYRK3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10726-ACG$345
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10726-ACR$345
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10726-ANG$345
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10726-ANR$345
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10726-CF$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10726-CH$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10726-CM$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10726-CY$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone)HG10726-M$195
Human DYRK3 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10726-M-F$395
Human DYRK3 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10726-M-N$395
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10726-NF$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10726-NH$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10726-NM$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10726-NY$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10726-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Dual specificity tyrosine-phosphorylation-regulated kinase 3, also known as Regulatory erythroid kinase, REDK and DYRK3, is a nucleus protein which belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family and MNB/DYRK subfamily. DYRKs are an emerging family of dual-specificity kinases that play key roles in cell proliferation, survival, and development. DYRK3 contains one protein kinase domain. Isoform 1 and isoform 2 of DYRK3 are highly expressed in testis and in hematopoietic tissue such as fetal liver, and bone marrow. Isoform 2 of DYRK3 is the predominant form in testis. Isoform 1 of DYRK3 is the predominant form in fetal liver and bone marrow. Isoform 1 and isoform 2 are present at low levels in heart, pancreas, lymph node, and thymus. DYRK3 is a negative regulator of EPO-dependent erythropoiesis. It may place an upper limit on red cell production during stress erythropoiesis. DYRK3 inhibits cell death due to cytokine withdrawal in hematopoietic progenitor cells. It may also act by regulating CREB/CRE signaling. DYRK3 proved to effectively inhibit NFAT (nuclear factor of activated T cells) transcriptional response pathways and to co-immunoprecipitate with NFATc3. DYRK3 attenuates (and possibly apportions) red cell production selectively during anemia.

  • Becker W., et al., 1998, J. Biol. Chem. 273: 25893-25902.
  • Himpel,S. et al., 2000,J Biol Chem  275 (4):2431-8.
  • Li,K. et al., 2002, J Biol Chem. 277 (49):47052-60.
  • Bogacheva,O. et al., 2008, J Biol Chem. 283 (52):36665-75.
  • Guo,X. et al., 2010, J Biol Chem.285 (17):13223-32.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items