After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human WFIKKN2 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human WFIKKN2 cDNA Clone Product Information
Gene_bank_ref_id:NM_175575.5
RefSeq ORF Size:1731bp
cDNA Description:Full length Clone DNA of Homo sapiens WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2 with N terminal Myc tag.
Gene Synonym:GASP-1, hGASP-1, WFIKKNRP, WFIKKN2
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

WAP, kazal, immunoglobulin, kunitz and NTR domain-containing protein 2, also known as Growth and differentiation factor-associated serum protein 1, WAP, follistatin, immunoglobulin, kunitz and NTR domain-containing-related protein, WFIKKN-related protein, WFIKKN2 and GASP1, is a secreted protein which belongs to the WFIKKN family. WFIKKN2 contains two BPTI/Kunitz inhibitor domains, one Ig-like C2-type (immunoglobulin-like) domain, one Kazal-like domain, one NTR domain and one WAP domain. WFIKKN2 is primarily expressed in ovary, testis and brain, but not in liver. In fetal tissues, it is primarily expressed in brain, skeletal muscle, thymus and kidney. WFIKKN2 is protease-inhibitor that contains multiple distinct protease inhibitor domains. It probably has serine protease- and metalloprotease-inhibitor activity. It inhibits the biological activity of mature myostatin, but not activin. WFIKKN2 protein binds mature GDF8/myostatin and myostatin propeptide and inhibits the biological activity of myostatin.

References
  • Clark H.F.et al., 2003,Genome Res. 13:2265-70.
  • Hill J.J.et al., 2003, Mol. Endocrinol. 17:1144-54.
  • Kondás,K. et al., 2008, J Biol Chem  283 (35):23677-84.
  • Size / Price
    Catalog: HG11998-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"