After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human HIF1A Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HIF1AcDNA Clone Product Information
cDNA Size:2481
cDNA Description:ORF Clone of Homo sapiens hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) DNA.
Gene Synonym:MOP1, HIF-1alpha, PASD8, HIF1, bHLHe78
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human HIF1A Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Related Products
Product nameProduct name

HIF-1 alpha, also known as HIF1A, contains 1 basic helix-loop-helix (bHLH) domain, 1 PAC (PAS-associated C-terminal) domain and 2 PAS (PER-ARNT-SIM) domains. It is one of the two subunits of Hypoxia-inducible factor-1 (HIF1). HIF1 is a transcription factor found in mammalian cells cultured under reduced oxygen tension that plays an essential role in cellular and systemic homeostatic responses to hypoxia. HIF1 is a heterodimer composed of an alpha subunit and a beta subunit. The beta subunit has been identified as the aryl hydrocarbon receptor nuclear translocator (ARNT). HIF-1 alpha is expressed in most tissues with highest levels in kidney and heart. It is overexpressed in the majority of common human cancers and their metastases, due to the presence of intratumoral hypoxia and as a result of mutations in genes encoding oncoproteins and tumor suppressors. HIF-1 alpha functions as a master transcriptional regulator of the adaptive response to hypoxia. Under hypoxic conditions, it activates the transcription of over 40 genes, including erythropoietin, glucose transporters, glycolytic enzymes, vascular endothelial growth factor, HILPDA, and other genes whose protein products increase oxygen delivery or facilitate metabolic adaptation to hypoxia. HIF1A plays an essential role in embryonic vascularization, tumor angiogenesis and pathophysiology of ischemic disease. HIF-1 alpha binds to core DNA sequence 5'-[AG]CGTG-3' within the hypoxia response element (HRE) of target gene promoters. Activation requires recruitment of transcriptional coactivators such as CREBPB and EP300.

  • Zhou Q, et al. (2011) Loss of either hypoxia inducible factor 1 or 2 promotes lung cancer cell colonization. Cell Cycle. 10(13):2233-4.
  • Krishnan J, et al. (2012) Dietary obesity-associated Hif1 alpha activation in adipocytes restricts fatty acid oxidation and energy expenditure via suppression of the Sirt2-NAD+ system. Genes Dev. 26(3):259-70.
  • Novo E, et al. (2012) The biphasic nature of hypoxia-induced directional migration of activated human hepatic stellate cells. J Pathol. 226(4):588-97.
  • Dungwa JV, et al. (2011) Overexpression of carbonic anhydrase and HIF-1 in Wilms tumours. BMC Cancer. 11:390.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items