After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human VNN2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
VNN2cDNA Clone Product Information
cDNA Size:1563
cDNA Description:ORF Clone of Homo sapiens vanin 2 DNA.
Gene Synonym:FOAP-4, GPI-80
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Vascular non-inflammatory molecule 2, also known as glycosyl-phosphatidyl inositol-anchored protein GPI-80, Vanin-2, Protein FOAP-4 and VNN2, is a cell membrane protein which belongs to the CN hydrolase family and Vanin subfamily. VNN2 is widely expressed with higher expression in spleen and blood. VNN2 is a member of the vanin family of proteins which share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. VNN2 is an amidohydrolase that hydrolyzes specifically one of the carboamide linkages in D-pantetheine thus recycling pantothenic acid (vitamin B5) and releasing cysteamine. It is involved in the thymus homing of bone marrow cells. VNN2 plays a role in transendothelial migration of neutrophils and may regulate beta-2 integrin-mediated cell adhesion, migration and motility of neutrophil.

  • Suzuki K. et al., 1999, J. Immunol. 162: 4277-84.
  • Martin, F. et al., 2001,Immunogenetics. 53 (4):296-306.
  • Liu al., 2005, J. Proteome Res. 4: 2070-80.
  • Jansen P.AM. et al., 2009, J. Invest. Dermatol. 129: 2167-74.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items