After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Canine WFDC2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
WFDC2cDNA Clone Product Information
Gene_bank_ref_id:NM_001003241.1
cDNA Size:525
cDNA Description:ORF Clone of Canis lupus familiaris WAP four-disulfide core domain 2 DNA.
Gene Synonym:CE4
Species:Canine
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

WAP four-disulfide core domain protein 2, also known as Epididymal secretory protein E4, Major epididymis-specific protein E4, Putative protease inhibitor WAP5, WFDC2 and HE4, is a secreted protein which contains two WAP domains. WFDC2 / HE4 is a member of a family of stable 4-disulfide core proteins that are secreted at high levels. It is expressed in a number of normal tissues, including male reproductive system, regions of the respiratory tract and nasopharynx. It is highly expressed in a number of tumors cells lines, such ovarian, colon, breast, lung and renal cells lines. Initially described as being exclusively transcribed in the epididymis. WFDC2 may be a component of the innate immune defences of the lung, nasal and oral cavities and suggest that WFDC2 functions in concert with related WAP domain containing proteins in epithelial host defence. WFDC2 re-expression in lung carcinomas may prove to be associated with tumour type and should be studied in further detail. Mammary gland expression of tammar WFDC2 during the course of lactation showed WFDC2 was elevated during pregnancy, reduced in early lactation and absent in mid-late lactation. WFDC2 / HE4 can undergo a complex series of alternative splicing events that can potentially yield five distinct WAP domain containing protein isoforms.

References
  • Bingle,L. et al., 2002, Oncogene. 21 (17):2768-73.
  • Hellström,I. et al., 2003, Cancer Res. 63 (13):3695-700.
  • Bingle,L. et al., 2006, Respir Res. 7 : 61.
  • Galgano,M.T. et al., 2006, Mod Pathol.19 (6):847-53.
  • Sharp,J.A. et al., 2007, Evol Dev. 9 (4): 378-92.
  • Size / Price
    Catalog:DG70012-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"