Quick Order

Text Size:AAA

Human PRKD2 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PRKD2 cDNA Clone Product Information
Gene_bank_ref_id:NM_016457.4
RefSeq ORF Size:2634bp
cDNA Description:Full length Clone DNA of Homo sapiens protein kinase D2PRKD2 protein kinase D2 with N terminal Myc tag.
Gene Synonym:PKD2, HSPC187
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Serine/threonine-protein kinase D2, also known as PRKD2 and PKD2, is a cytoplasm and membrane protein which belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family and PKD subfamily. PRKD2 / PKD2 is widely expressed. It contains one PH domain, two phorbol-ester/DAG-type zinc fingers and one protein kinase domain. PRKD2 / PKD2 is activated by DAG and phorbol esters. Phorbol-ester/DAG-type domains bind DAG, mediating translocation to membranes. Autophosphorylation of Ser-710 and phosphorylation of Ser-706 by PKC relieves auto-inhibition by the PH domain. PRKD2 / PKD2 converts transient diacylglycerol (DAG) signals into prolonged physiological effects, downstream of PKC. Involved in resistance to oxidative stress.

References
  • Zhang QH, et al., 2000, Genome Res 10 (10): 1546-60.
  • Di Bernardo MC, et al.,2008, Nature genetics. 40 (10) :1204-10.
  • Zhang L, et al., 2009, American journal of nephrology. 30 (6) :505-13.
  • Size / Price
    Catalog: HG11671-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"