After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PTK6cDNA Clone Product Information
cDNA Size:1356
cDNA Description:ORF Clone of Homo sapiens PTK6 protein tyrosine kinase 6 DNA.
Gene Synonym:BRK, FLJ42088, PTK6
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10682-ACG$325
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10682-ACR$325
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10682-ANG$325
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10682-ANR$325
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10682-CF$295
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10682-CH$295
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10682-CM$295
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10682-CY$295
Human BRK Gene cDNA Clone (full-length ORF Clone)HG10682-M$95
Human BRK Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10682-M-F$295
Human BRK Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10682-M-N$295
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10682-NF$295
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10682-NH$295
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10682-NM$295
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10682-NY$295
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10682-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Tyrosine kinase (PTKs) is a protein that carry out tyrosine phosphorylation, which play a fundamental role in cell proliferation, survival, adhesion, and motility and have also been demenstrated to mediate malignant cell transformation. Overexpression of this protein in mammary epithelial cells leads to sensitization of the cells to epidermal growth factor and results in a partially transformed phenotype. Two classes of PTKs are present in cells: the transmembrane receptor PTKs and the non-receptor PTKs. Tyrosine kinase(PTKs)-6/ BRK is a cytoplasmic non-receptor protein kinase which may function as an intracellular signal transducer in epithelial tissues. Tyrosine kinase(PTKs)-6/ BRK has been shown to undergo autophosphorylation. It has been found that the constitutive expression of the tyrosine kinase(PTKs)-6/ BRK is in a large proportion of cutaneous T-cell lymphomas and other transformed T- and B-cell populations. State BRK expression was also induced in normal T-cells. In clinical, the cytoplasmic tyrosine kinase PTK6 (BRK) shows elevated expression in approximately two-thirds of primary breast tumours, and is implicated in EGF receptor-dependent signalling and epithelial tumorigenesis.

  • Aubele M, et al. (2008) Prognostic value of protein tyrosine kinase 6 (PTK6) for long-term survival of breast cancer patients.British Journal of Cancer. 99: 1089-95.
  • Kasprzycka M, et al. (2006) Expression and oncogenic role of Brk (PTK6/sik) protein tyrosine kinase in lymphocytes. American Journal of Pathology. 168: 1631-41.
  • Hubbard SR, et al. (2000) Protein tyrosine kinase structure and function. Annual review of biochemistry. 69: 373-98.