After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Canine KIM1 / TIM1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Canine HAVCR1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001205114.1
RefSeq ORF Size:705bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris hepatitis A virus cellular receptor 1 with N terminal His tag.
Gene Synonym:KIM1, TIM1, HAVCR, KIM-1, TIM-1, TIMD1, HAVCR-1
Species:Canine
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Human HAV cellular receptor 1 (HAVCR1), also known as Kidney injury molecule 1 (KIM-1) and T cell immunoglobulinmucin 1 (TIM-1), is a type â…  integral membrane glycoprotein. KIM-1 protein is widely expressed with highest levels in kidney and testis. It has been shown to play a major role as a human susceptibility gene for asthma, allergy and autoimmunity. IgA1lambda is a specific ligand of KIM-1 protein and that their association has a synergistic effect in virus-receptor interactions. KIM-1 involves in the pathogenesis of acute kidney injury. It had been confirmed that KIM-1 is a human urinary renal dysfunction biomarker. Moreover, KIM-1 protein is a novel regulatory molecule of flow-induced calcium signaling.

References
  • Tami C, et al. (2007) Immunoglobulin A (IgA) is a natural ligand of hepatitis A virus cellular receptor 1 (HAVCR1), and the association of IgA with HAVCR1 enhances virus-receptor interactions. J Virol. 81(7): 3437-46.
  • Rees AJ, et al. (2008) Kim-1/Tim-1: from biomarker to therapeutic target? Nephrol Dial Transplant. 23(11): 3394-6.
  • Chaturvedi S, et al. (2009) Assay validation for KIM-1: human urinary renal dysfunction biomarker. Int J Biol Sci. 5(2): 128-34.
  • Size / Price
    Catalog: DG70001-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"