Quick Order

Text Size:AAA

Human VNN1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human VNN1 cDNA Clone Product Information
Gene_bank_ref_id:NM_004666.2
RefSeq ORF Size:1542bp
cDNA Description:Full length Clone DNA of Homo sapiens vanin 1 with N terminal Myc tag.
Gene Synonym:HDLCQ8, Tiff66, MGC116930, MGC116931, MGC116932, MGC116933, VNN1
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Pantetheinase, also known as Pantetheine hydrolase, Vascular non-inflammatory molecule 1, Vanin-1, and VNN1, is a cell membrane protein which belongs to the CN hydrolase family and BTD/VNN subfamily. Vanin-1 contains one CN hydrolase domain. It is widely expressed with higher expression in spleen, kidney and blood. It is overexpressed in lesional psoriatic skin. Vanin-1 is also a member of the Vanin family of proteins which share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. Vanin-1 is an epithelial pantetheinase that provides cysteamine to tissue and regulates response to stress. Vanin-1 is expressed by enterocytes, and its absence limits intestinal epithelial cell production of proinflammatory signals. Vanin-1 regulates late adhesion steps of thymus homing under physiological, noninflammatory conditions. The early impact of vanin-1 deficiency on tumor induction was directly correlated to the amount of inflammation and subsequent epithelial proliferation rather than cell death rate. Vanin-1 molecule was shown to be involved in the control of thymus reconstitution following sublethal irradiation.

References
  • Aurrand-Lions M, et al. (1996) Vanin-1, a Novel GPI-Linked Perivascular Molecule Involved in Thymus Homing. Immunity. 5 (5): 391-405.
  • Grimmond S, et al. (2000) Sexually dimorphic expression of protease nexin-1 and vanin-1 in the developing mouse gonad prior to overt differentiation suggests a role in mammalian sexual development. Hum Mol Genet. 9 (10): 1553-60.
  • Meghari S, et al. (2007) Vanin-1 controls granuloma formation and macrophage polarization in Coxiella burnetii infection. Eur J Immunol. 37 (1): 24-32.
  • Size / Price
    Catalog: HG11662-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"