Quick Order

Human RAMP3 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RAMP3 cDNA Clone Product Information
Gene_bank_ref_id:BC053852
RefSeq ORF Size:447bp
cDNA Description:Full length Clone DNA of Homo sapiens receptor (G protein-coupled) activity modifying protein 3 with C terminal Myc tag.
Gene Synonym:RAMP3
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

RAMP3 belongs to the RAMP family. Members of this family are single-transmembrane-domain proteins, called receptor (calcitonin) activity modifying proteins (RAMPs). RAMPs have a wide biological distribution; high concentrations are found in the brain, lung, liver, heart and spleen with lower expression levels present in the testes, gastrointestinal tract and thyroid. RAMPs are type I transmembrane proteins with an extracellular N terminus and a cytoplasmic C terminus. They are required to transport calcitonin-receptor-like receptor (CRLR) to the plasma membrane. CRLR, a receptor with seven transmembrane domains, can function as either a calcitonin gene-related peptide (CGRP) receptor or an adrenomedullin receptor, depending on which members of the RAMP family are expressed. In the presence of RAMP3 protein, CRLR functions as an adrenomedullin receptor.

References
  • Stelzl U, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-68.
  • Scherer SW, et al. (2003) Human chromosome 7: DNA sequence and biology. Science. 300(5620):767-72.
  • Kuwasako K, et al. (2004) Characterization of the human calcitonin gene-related peptide receptor subtypes associated with receptor activity-modifying proteins. Mol Pharmacol. 65(1):207-13.
  • Size / Price
    Catalog: HG13744-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"