After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human XCL1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
XCL1cDNA Clone Product Information
Gene_bank_ref_id:NM_002995.1
cDNA Size:345
cDNA Description:ORF Clone of Homo sapiens chemokine (C motif) ligand 1 DNA.
Gene Synonym:LTN, ATAC, LPTN, SCM1, SCM-1, SCYC1, SCM-1a, XCL1
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Chemokine & Receptor Related Products
Product nameProduct name
References
  • Nguyen KD, et al. (2008) XCL1 enhances regulatory activities of CD4+ CD25(high) CD127(low/-) T cells in human allergic asthma. J Immunol. 181 (8): 5386-95.
  • Dong C, et al. (2005) Glycosylated recombinant human XCL1 / lymphotactin exhibits enhanced biologic activity. J Immunol Methods. 302 (1-2): 136-44.
  • Zavala-Flores LM, et al. (2009) Production of biologically active human lymphotactin (XCL1) by Lactococcus lactis. Biotechnol Lett. 31 (2): 215-20.
  • Size / Price
    Catalog:HG10672-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"