Quick Order

Rhesus SCG3 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus SCG3 cDNA Clone Product Information
Gene_bank_ref_id:NM_001260692.1
RefSeq ORF Size:1407bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) secretogranin III with N terminal His tag.
Gene Synonym:SCG3
Species:Rhesus
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

SCG3, also known as secretogranin 3, is a member of the chromogranin/secretogranin family. Members of this family may serve as precursors for biologically active peptides. SCG3 is transported to secretory granules (SGs) in neuroendocrine cells. SCG3 binds strongly to chromogranin A (CgA) in an intragranular milieu and targets CgA to SGs in pituitary and pancreatic endocrine cells. With a sucrose density gradient of rat insulinoma-derived INS-1 cell homogenates, SgIII is localized to the SG fraction and is fractionated to the SG membrane (SGM) despite lacking the transmembrane region.

References
>
  • Rong YP. et al., 2002, Sheng Wu Wu Li Xue Bao. 34 (4): 411-7.
  • Huttner WB. et al., 1991, Trends Biochem Sci. 16 (1): 27-30.
  • Ozawa H. et al., 1996, Cell Struct Funct. 20 (6): 415-20.
  • Size / Price
    Catalog: CG90789-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"