Quick Order

Human AZU1 / HBP ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AZU1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001700.3
RefSeq ORF Size:756bp
cDNA Description:Full length Clone DNA of Homo sapiens azurocidin 1 with C terminal His tag.
Gene Synonym:AZU, HBP, NAZC, AZAMP, CAP37, HUMAZUR, AZU1
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Azurocidin (AZU1), also known as heparin-binding protein (HBP) or cationic antimicrobial protein 37 (CAP37), is an azurophil granule antibiotic protein, with monocyte chemotactic and antibacterial activity. The Azurophil granules, specialized lysosomes of the neutrophil, contain at least 10 proteins implicated in the killing of microorganisms. Azurocidin is a member of the serine protease family that includes Cathepsin G, neutrophil elastase (NE), and proteinase 3 (PR3), however, Azurocidin is not a serine proteinase since the active site serine and histidine residues are replaced. Neutrophils arriving first at sites of inflammation release Azurocidin, which acts in a paracrine fashion on endothelial cells causing the development of intercellular gaps and allowing leukocyte extravasation. It thus be regarded as a reasonable therapeutic target for a variety of inflammatory disease conditions.

References
  • Lindmark A, et al. (1999) Characterization of the biosynthesis, processing, and sorting of human HBP/CAP37/azurocidin. J Leukoc Biol. 66(4): 634-43.
  • Heinzelmann M, et al. (2001) Heparin binding protein (CAP37) differentially modulates endotoxin-induced cytokine production. Int J Surg Investig. 2(6): 457-66.
  • Soehnlein O, et al. (2005) Neutrophil-derived heparin-binding protein (HBP/CAP37) deposited on endothelium enhances monocyte arrest under flow conditions. J Immunol. 174(10): 6399-405.
  • Size / Price
    Catalog: HG10660-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"