After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human REG3G Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
REG3GcDNA Clone Product Information
cDNA Size:528
cDNA Description:ORF Clone of Homo sapiens lumican DNA.
Gene Synonym:PAP1B, PAPIB, UNQ429, REG-III, MGC118998, MGC118999, MGC119001, REG3G
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Regenerating gene (Reg), first isolated from a regenerating islet cDNA library, encodes a secretory protein with a growth stimulating effect on pancreatic beta cells. Reg and Reg-related genes which were expressed in various organs have been revealed to constitute a multigene family, the Reg family, which consists of four subtypes (types I, II, III, IV) based on the primary structures of the encoded proteins of the genes, which are associated with tissue repair and have been directly implicated in pancreatic beta-cell regeneration. Reg proteins are expressed in various organs and are involved in cancers and neurodegenerative diseases. They display a typical C-type lectin-like domain but possess additional highly conserved amino acids. Regenerating islet-derived 3 gamma (REG3G), also known as pancreatitis-associated protein 1B (PAP1B), is a member of the secreted Reg superfamily and contains one typical C-type lectin domain. REG3G is expressed weakly in pancreas, strongly in intestinal tract, but not in hyperplastic islets REG3G might be a stress protein involved in the control of bacterial proliferation. It was indicated that REG3G specifically targets Gram-positive bacteria because it binds to their surface peptidoglycan layer, and serves as one of several antimicrobial peptides produced by paneth cells via stimulation of toll-like receptors (TLRs) by pathogen-associated molecular patterns (PAMPs).

  • Narushima Y, et al. (1997) Structure, chromosomal localization and expression of mouse genes encoding type III Reg, RegIII alpha, RegIII beta, RegIII gamma. Gene. 185(2): 159-68.
  • Nata K, et al. (2004) Molecular cloning, expression and chromosomal localization of a novel human REG family gene, REG III. Gene. 340(1): 161-70.
  • Laurine E, et al. (2005) PAP IB, a new member of the Reg gene family: cloning, expression, structural properties, and evolution by gene duplication. Biochim Biophys Acta. 1727(3): 177-87.
  • Castellarin ML, et al. (2007) The identification and sequence analysis of a new Reg3gamma and Reg2 in the Syrian golden hamster. Biochim Biophys Acta. 1769(9-10): 579-85.