Quick Order

Text Size:AAA

Human LYZL2 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LYZL2 cDNA Clone Product Information
Gene_bank_ref_id:BC066294
RefSeq ORF Size:585bp
cDNA Description:Full length Clone DNA of Homo sapiens lysozyme-like 2 with C terminal Myc tag.
Gene Synonym:LYZL2
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Lysozyme 2 gene is a member of a family of lysozyme-like genes. Lysozymes, especially C-type lysozymes, are well-recognized bacteriolytic factors widely distributed in the animal kingdom and play a mainly protective role in host defense. Lysozymes damage bacterial cell walls by catalyzing hydrolysis of 1,4-beta-linkages between N-acetylmuramic acid and N-acetyl-D-glucosamine residues in a peptidoglycan and between N-acetyl-D-glucosamine residues in chitodextrins.

Lysozyme is part of the innate immune system. Reduced lysozyme levels have been associated with bronchopulmonary dysplasia in newborns. In certain cancers (especially myelomonocytic leukemia) excessive production of lysozyme by cancer cells can lead to toxic levels of lysozyme in the blood. High lysozyme blood levels can lead to kidney failure and low blood potassium, conditions that may improve or resolve with treatment of the primary malignancy.

References
  • Lamesch P. et al., 2007, Genomics. 89 (3): 307-15.
  • Argyropoulos G. et al., 2009, Physiol Genomics. 36 (2): 79-88.
  • Deloukas P. et al., 2004, Nature. 429 (6990): 375-81.
  • Size / Price
    Catalog: HG13726-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"