Quick Order

Human DLL1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DLL1cDNA Clone Product Information
cDNA Size:2214
cDNA Description:ORF Clone of Homo sapiens delta-like 1 (Drosophila) DNA.
Gene Synonym:DL1, Delta, DELTA1, DLL1
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation: 1422 G/A not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Delta-like protein 1(DLL1), also known as Delta1, a single-pass type I membrane protein which contains one DSL domain and eight EGF-like domains,  acts as a ligand for Notch receptors, and positively regulates T-cell development. DLL1 is proteolytically processed in a similar manner to the Notch receptor, and it has been speculated to participate in bidirectional signaling. The proteolytic processing of DLL1 helps achieve an asymmetry in Notch signaling in initially equivalent myogenic cells and helps sustain the balance between differentiation and self-renewal. Interactions between DLL1 and Notch in trans activate the Notch pathway, whereas DLL1 binding to Notch in cis inhibits Notch signaling. DLL1 undergoes proteolytic processing in its extracellular domain by ADAM10. It had been demonstrated that DLL1 represents a substrate for several other members of the ADAM family. In co-transfected cells, DLL1 is constitutively cleaved by ADAM12, and the N-terminal fragment of DLL1 is released to medium. ADAM12-mediated cleavage of DLL1 is cell density-dependent, takes place in cis orientation, and does not require the presence of the cytoplasmic domain of ADAM12. Full-length DLL1, but not its N- or C-terminal proteolytic fragment, co-immunoprecipitates with ADAM12. By using a Notch reporter construct, we show that DLL1 processing by ADAM12 increases Notch signaling in a cell-autonomous manner. Furthermore, ADAM9 and ADAM17 have the ability to process DLL1. In contrast, ADAM15 does not cleave DLL1, although the two proteins still co-immunoprecipitate with each other. During fetal development, DLL1 is an essential Notch ligand in the vascular endothelium of large arteries to activate Notch1 and maintain arterial identity. DLL1-Notch signaling was required for VEGF receptor expression in fetal arteries.

  • Dyczynska E, et al. (2007) Proteolytic processing of delta-like 1 by ADAM proteases. J Biol Chem. 282(1): 436-44.
  • Sun D, et al. (2008) The role of Delta-like 1 shedding in muscle cell self-renewal and differentiation. J Cell Sci. 121(Pt 22): 3815-23.
  • Srensen I, et al. (2009) DLL1-mediated Notch activation regulates endothelial identity in mouse fetal arteries. Blood. 113(22): 5680-8.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability5 Business days
    • Human DLL1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged
    Recently Viewed Items