Quick Order

Human SPOCK1 / TICN1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SPOCK1 cDNA Clone Product Information
Gene_bank_ref_id:BC030691.2
RefSeq ORF Size:1320bp
cDNA Description:Full length Clone DNA of Homo sapiens sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1 with C terminal His tag.
Gene Synonym:TIC1, SPOCK, FLJ37170, TESTICAN
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Osteonectin, also known as SPOCK1, is an extracellular heparan/chondroitin sulfate proteoglycan. Members of this family are known as testicans, also called SPOCKs. They are characterized structurally by an N-terminal testican-specific domain, a follistatin-like region, a calcium-binding domain, a thyroglobulin-like domain, and an acidic C-terminal domain with two putative glycosaminoglycan attachment sites. SPOCKs are enriched in brain and have been shown to regulate neuronal attachment and outgrowth. They contain inhibitory regions in several domains targeted to different classes of protease, and in some cases may act as protease inhibitors. Osteonectin contains 1 Kazal-like domain and 1 thyroglobulin type-1 domain. Up to now, little is known about osteonectin’s function. It may play a role in cell-cell and cell-matrix interactions. Osteonectin also may contribute to various neuronal mechanisms in the central nervous system.

Size / Price
Catalog: HG10644-CH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"