After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human RLN1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RLN1cDNA Clone Product Information
Gene_bank_ref_id:NM_006911.2
cDNA Size:558
cDNA Description:ORF Clone of Homo sapiens relaxin 1 DNA.
Gene Synonym:H1, RLXH1, bA12D24.3.1, bA12D24.3.2, RLN1
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

Relaxin-1, also known as Prorelaxin H1 and RLN1, is a secreted protein which belongs to the insulin family. It is a peptide hormone that was first described in 1926 by Frederick Hisaw. Since its discovery as a reproductive hormone 80 years ago, relaxin has been implicated in a number of pregnancy-related functions involving extracellular matrix (ECM) turnover and collagen degradation. It is now becoming evident that relaxin's ability to reduce matrix synthesis and increase ECM degradation has important implications in several nonreproductive organs, including the heart, lung, kidney, liver and skin. The relaxin-like peptide family belongs in the insulin superfamily and consists of 7 peptides of high structural but low sequence similarity; relaxin-1 (RNL1), relaxin-2 (RNL2) and relaxin-3 ( RNL3), and the insulin-like (INSL) peptides, INSL3, INSL4, INSL5 and INSL6. The functions of relaxin-3, INSL4, INSL5, INSL6 remain uncharacterised. Relaxin-1 / RLN1 is an ovarian hormone that acts with estrogen to produce dilatation of the birth canal in many mammals. Relaxin-1 / RLN1 may be involved in remodeling of connective tissues during pregnancy, promoting growth of pubic ligaments and ripening of the cervix. Relaxin and estrogen appear to play protective roles against airway fibrosis, airway SM thickening, and cardiac hypertrophy. Relaxin may also provide a means to regulate excessive collagen deposition during kidney development and in diseased states characterized by renal fibrosis.

References
  • Bathgate,R.A. et al., 2003, ends Endocrinol Metab  14 (5):207-13.
  • Samuel,C.S. et al., 2003, Curr Opin Pharmacol. 3 (2):152-8.
  • Samuel,C.S. et al., 2004,Kidney Int. 65 (6):2054-64.
  • Lekgabe,E.D. et al., 2006, Endocrinology. 147 (12):5575-83.
  • Samuel,C.S. et al., 2007, Adv Exp Med Biol  612: 88-103.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"