Quick Order

Human SerpinB2 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SERPINB2 cDNA Clone Product Information
Gene_bank_ref_id:NM_002575.1
RefSeq ORF Size:1248bp
cDNA Description:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 2 with C terminal His tag.
Gene Synonym:PAI, PAI2, PAI-2, PLANH2, HsT1201
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner.
SerpinB2, also known as Plasminogen activator inhibitor 2, Placental plasminogen activator inhibitor, Monocyte Arg-serpin, Urokinase inhibitor and PAI2, is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. SerpinB2 is a major product of activated monocytes and macrophages and is substantially induced during most inflammatory processes. Distinct from its widely described extracellular role as an inhibitor of urokinase plasminogen activator. SerpinB2 has been shown to have an intracellular role as a retinoblastoma protein (Rb)-binding protein that inhibits Rb degradation. SerpinB2 is widely described as an inhibitor of urokinase plasminogen activator. SerpinB2 inhibits urokinase-type plasminogen activator. The monocyte derived SerpinB2 is distinct from the endothelial cell-derived PAI-1. SerpinB2 is a potentially important inducible host factor that significantly promotes HIV-1 replication.

References
  • Sumi, Y. et al., 1989, J. Biochem. 106: 703-7.
  • Rawlings, N.D. et al., 2004, Biochem J. 378: 705-16.
  • Gillard, A. et al., 2006, Am J Nephrol. 26 (1): 34-42.
  • Schroder,WA. et al., 2010, J Immunol. 184 (5): 2663-70.
  • Size / Price
    Catalog: HG10641-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"