After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CD200R1L / CD200RLa Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD200R1LcDNA Clone Product Information
cDNA Size:816
cDNA Description:ORF Clone of Homo sapiens CD200 receptor 1-like DNA.
Gene Synonym:CD200R2, CD200RLa, CD200R1L
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Cell surface glycoprotein CD200 receptor 2, also known as Cell surface glycoprotein CD200 receptor 1-like, Cell surface glycoprotein OX2 receptor 2, CD200 receptor-like 2, CD200Rla, CD200R1L and CD200R2, is a single-pass type I  membrane protein which belongs to the CD200R family. CD200R1L / CD200R2. It contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. CD200 is a transmembrane protein delivering immunoregulatory signals after engagement of CD200R. A family of CD200Rs exist ( CD200R1, CD200R2, CD200R3, CD200R4 ) with different tissue expression and functional activity. In the presence of anti-CD200R2 / CD200R3 monoclonal antibodies (mAbs), bone-marrow cells cultured in the presence of (interleukin [IL]-4+granulocyte-macrophage colony-stimulating factor) differentiate into dendritic cells (DCs), which induce CD4+CD25+ Treg. Interaction between the relatively ubiquitously expressed molecule CD200 and one of its receptors, CD200R1, resulted in direct suppression of alloreactivity, engagement of alternate receptors led instead to altered differentiation of dendritic cells (DCs) from marrow precursors, which could in turn foster development of Foxp3(+) regulatory T cells. Unlike anti-CD200R1, anti-CD200R2 both promotes development of DCs with capacity to induce Treg and directly augments thymocyte production of Treg.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items