Quick Order

Text Size:AAA

Human RP2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RP2cDNA Clone Product Information
cDNA Size:1053
cDNA Description:ORF Clone of Homo sapiens retinitis pigmentosa 2 (X-linked recessive) DNA.
Gene Synonym:TBCCD2, KIAA0215
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

XRP2, also known as Protein XRP2 and RP2, is a member of the TBCC (tubulin cofactor C) family and contains one C-CAP/cofactor C-like domain. This protein is encoded by the RP2 gene in humans. XRP2 stimulates the GTPase activity of tubulin, but does not enhance tubulin heterodimerization. XRP2 acts as guanine nucleotide dissociation inhibitor for ARL3. Defects in RP2 gene are the cause of retinitis pigmentosa type 2 (RP2), also known as X-linked retinitis pigmentosa 2 (XLRP-2). It leads to degeneration of retinal photoreceptor cells. Patients typically have night vision blindness and loss of midperipheral visual field. As their condition progresses, they lose their far peripheral visual field and eventually central vision as well. 

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items