After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human NLGN1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NLGN1 cDNA Clone Product Information
Gene_bank_ref_id:NM_014932.2
RefSeq ORF Size:2472bp
cDNA Description:Full length Clone DNA of Homo sapiens neuroligin 1 with N terminal Myc tag.
Gene Synonym:KIAA1070, MGC45115, NLGN1
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Neuroligin 1 (NLGN1) belongs to the type-B carboxylesterase/lipase family, is a synaptic cell-adhesion molecule that is enriched in postsynaptic densities where it may recruit receptors, channels, and signal-transduction molecules to synaptic sites of cell adhesion. Neuroligins consist of five members (NLGN1, NLGN2, NLGN3, NLGN4 and NLGN4Y), which interact with beta-neurexins and this interaction is involved in the formation of functional synapses. The extracellular domain of functional Neuroligin 1 associates as a dimer when analyzed by sedimentation equilibrium. Neuroligin 1 has a unique N-linked glycosylation pattern in the neuroligin family, and glycosylation and its processing modify neuroligin activity. Neuroligin 1 is a potent trigger for the de novo formation of synaptic connections, and it has recently been suggested that it is required for the maturation of functionally competent excitatory synapses. The persistent expression of Neuroligin 1 is required for the maintenance of NMDAR-mediated synaptic transmission, which enables normal development of synaptic plasticity and long-term memory in the amygdala of adult animals.

References
  • Song JY, et al. (1999) Neuroligin 1 is a postsynaptic cell-adhesion molecule of excitatory synapses. Proc Natl Acad Sci U S A. 96(3): 1100-5.
  • Comoletti D, et al. (2003) Characterization of the interaction of a recombinant soluble neuroligin-1 with neurexin-1beta. J Biol Chem. 278(50): 50497-505.
  • Ylisaukko-oja T, et al. (2005) Analysis of four neuroligin genes as candidates for autism. Eur J Hum Genet. 13(12): 1285-92.
  • Kim J, et al. (2008) Neuroligin-1 is required for normal expression of LTP and associative fear memory in the amygdala of adult animals. Proc Natl Acad Sci U S A. 105(26): 9087-92.
  • Schapitz IU, et al. (2010) Neuroligin 1 is dynamically exchanged at postsynaptic sites. J Neurosci. 30(38): 12733-44.
  • Size / Price
    Catalog: HG11617-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"