After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human NME1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NME1cDNA Clone Product Information
cDNA Size:459
cDNA Description:ORF Clone of Homo sapiens non-metastatic cells 1, protein (NM23A) expressed in DNA.
Gene Synonym:NB, AWD, NBS, GAAD, NM23, NDPKA, NDPK-A, NM23-H1, NME1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

NME1, also known as Nucleoside Diphosphate Kinase A (NDK-A), or NM23-H1, belongs to the NDK family. NM23-H1 is known to have a metastasis suppressive activity in many tumor cells. Recent studies have shown that the interacting proteins with NM23-H1 which mediate the cell proliferation, may act as modulators of the metastasis suppressor activity. The interacting proteins with NM23-H1 can be classified into 3 groups. The first group of proteins can be classified as upstream kinases of NM23-H1 such as CKI and Aurora-A/STK15. The second group of proteins acts as downstream effectors for the regulation of specific gene transcriptions, GTP-binding protein functions, and signal transduction in Erk signal cascade. The third group of proteins can be classified as bi-directionally influencing binding partners of NM23-H1. As a result, the interactions with NM23-H1 and binding partners have implications in the biochemical characterization involved in metastasis and tumorigenesis. NDKA is increased in human postmortem cerebrospinal fluid (CSF), a model of global brain insult, suggesting that measurement in CSF and, more importantly, in plasma may be useful as a biomarker of stroke. Additionally, NM23-H1 significantly reduces metastasis without effects on primary tumor size and was the first discovered metastasis suppressor gene.

  • Allard L, et al. (2005) PARK7 and nucleoside diphosphate kinase A as plasma markers for the early diagnosis of stroke. Clin Chem. 51(11): 2043-51.
  • Steeg PS, et al. (2008) Clinical-translational approaches to the Nm23-H1 metastasis suppressor. Clin Cancer Res. 14(16): 5006-12.
  • Kim HD, et al. (2009) Regulators affecting the metastasis suppressor activity of Nm23-H1. Mol Cell Biochem. 329(1-2): 167-73.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items