Quick Order

Text Size:AAA

Human ALDH7A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ALDH7A1cDNA Clone Product Information
cDNA Size:1536
cDNA Description:ORF Clone of Homo sapiens aldehyde dehydrogenase 7 family, member A1 DNA.
Gene Synonym:EPD, PDE, ATQ1, FLJ11738, FLJ92814, ALDH7A1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human ALDH7A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Related Products
Product nameProduct name

ALDH7A1 (Aldehyde dehydrogenase 7 family, member A1) is a member of subfamily 7 in the aldehyde dehydrogenase family. These enzymes are thought to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. Mammalian ALDH7A1 is homologous to plant ALDH7B1 which protects against various forms of stress such as increased salinity, dehydration and treatment with oxidants or pesticides. In mammals, ALDH7A1 is known to play a primary role during lysine catabolism through the NAD+-dependent oxidative conversion of aminoadipate semialdehyde (AASA) to its corresponding carboxylic acid, α-aminoadipic acid. Deleterious mutations in human ALDH7A1 are responsible for pyridoxine-dependent and folinic acid-responsive seizures. ALDH7A1 is a novel aldehyde dehydrogenase expressed in multiple subcellular compartments that protects against hyperosmotic stress by generating osmolytes and metabolizing toxic aldehydes.

  • Brocker C, et al. (2011) Aldehyde dehydrogenase 7A1 (ALDH7A1) attenuates reactive aldehyde and oxidative stress induced cytotoxicity. Chem Biol Interact. 191(1-3): 269-77.
  • Brocker C, et al. (2010) Aldehyde dehydrogenase 7A1 (ALDH7A1) is a novel enzyme involved in cellular defense against hyperosmotic stress. J Biol Chem. 285(24): 18452-63.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items