After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ASGR2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ASGR2cDNA Clone Product Information
cDNA Size:948
cDNA Description:ORF Clone of Homo sapiens asialoglycoprotein receptor 2, transcript variant 2 DNA.
Gene Synonym:HL-2, HBXBP, ASGPR2, ASGP-R2, CLEC4H2, ASGR2
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human ASGR2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Related Products
Product nameProduct name

ASGR2 is a subunit of the asialoglycoprotein receptor. Asialoglycoprotein receptor, also known as the Ashwell receptor, which is specific for desialylated (galactosyl-terminal) glycoproteins and is expressed exclusively in hepatic parenchymal cells. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. ASGR2 is a glycoprotein. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. ASGR2 is the less abundant minor subunit.

  • Davila S, et al. (2010) New genetic associations detected in a host response study to hepatitis B vaccine. Genes Immun. 11(3):232-8.
  • Zhang X, et al. (2011) Asialoglycoprotein receptor interacts with the preS1 domain of hepatitis B virus in vivo and in vitro. Arch Virol. 156(4):637-45.
  • Guy CS, et al. (2011) Hepatocyte cytotoxicity is facilitated by asialoglycoprotein receptor. Hepatology. 54(3):1043-50.