After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human LRRN3 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LRRN3 cDNA Clone Product Information
Gene_bank_ref_id:BC035133.2
RefSeq ORF Size:2127bp
cDNA Description:Full length Clone DNA of Homo sapiens leucine rich repeat neuronal 3 with N terminal Myc tag.
Gene Synonym:NLRR3, NLRR-3, FIGLER5, FLJ11129, LRRN3
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Leucine-rich repeat neuronal protein 3, also known as neuronal leucine-rich repeat protein 3 (NLRR-3), is a member of leucine-rich (LRR) family whose members have significant functions in neural development. Leucine-rich repeats are short sequence motifs present in a number of proteins with diverse functions and cellular locations. All proteins containing these repeats are thought to be involved in protein-protein interactions. The crystal structure of ribonuclease inhibitor protein has revealed that leucine-rich repeats correspond to β-α structural units. These units are arranged so that they form a parallel β-sheet with one surface exposed to solvent, so that the protein acquires an unusual, non-globular shape. These two features may be responsible for the protein-binding functions of proteins containing leucine-rich repeats. LRRN3 plays an important role in cerebellum postnatal development. In a unilateral cortical injury cerebral cortex, NLRR-3 mRNA increased in layers 2-3 which suggests that NLRR-3 may be an important component of the pathophysiological response to brain injury. 

References
  • Yang J, et al. (2011) Role of LRRN3 in the cerebellum postnatal development in rats. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 36 (5): 424-9.
  • Hutcheson HB, et al. (2004) Examination of NRCAM, LRRN3, KIAA0716, and LAMB1 as autism candidate genes. BMC Med Genet. 5: 12.
  • Ishii N, et al. (1996) Increased expression of NLRR-3 mRNA after cortical brain injury in mouse. Brain Res Mol Brain Res. 40 (1): 148-52.
  • Size / Price
    Catalog: HG11610-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"