After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey RBBP4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RBBP4cDNA Clone Product Information
cDNA Size:1278
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) retinoblastoma binding protein 4 DNA.
Gene Synonym:RBBP4
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Cynomolgus monkey RBBP4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Cynomolgus monkey RBBP4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90743-ACG$325
Cynomolgus monkey RBBP4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90743-ACR$325
Cynomolgus monkey RBBP4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90743-ANG$325
Cynomolgus monkey RBBP4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90743-ANR$325
Cynomolgus monkey RBBP4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90743-CF$295
Cynomolgus monkey RBBP4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90743-CH$295
Cynomolgus monkey RBBP4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90743-CM$295
Cynomolgus monkey RBBP4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90743-CY$295
Cynomolgus monkey RBBP4 Gene cDNA Clone (full-length ORF Clone)CG90743-G$95
Cynomolgus monkey RBBP4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90743-NF$295
Cynomolgus monkey RBBP4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90743-NH$295
Cynomolgus monkey RBBP4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90743-NM$295
Cynomolgus monkey RBBP4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90743-NY$295
Cynomolgus monkey RBBP4 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90743-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Histone-binding protein RBBP4, also known as Retinoblastoma-binding protein 4, Retinoblastoma-binding protein p48, Chromatin assembly factor 1 subunit C, Chromatin assembly factor I p48 subunit, Nucleosome-remodeling factor subunit RBAP48 and RBBP4, is a nucleus protein which belongs to the WD repeat RBAP46/RBAP48/MSI1 family. RBBP4 is a core histone-binding subunit that may target chromatin assembly factors, chromatin remodeling factors and histone deacetylases to their histone substrates in a manner that is regulated by nucleosomal DNA. RBBP4 is a component of several complexes which regulate chromatin metabolism. These include the chromatin assembly factor 1 (CAF-1) complex, which is required for chromatin assembly following DNA replication and DNA repair; the core histone deacetylase (HDAC) complex, which promotes histone deacetylation and consequent transcriptional repression; the nucleosome remodeling and histone deacetylase complex (the NuRD complex), which promotes transcriptional repression by histone deacetylation and nucleosome remodeling and the NURF (nucleosome remodeling factor) complex.

One common myth is that age-related memory loss is an early indication of Alzheimer's disease. But researchers at the Columbia University Medical Center in New York City have found a specific protein, RbAp48, that they believe is responsible for age-related memory problems. What's more, by replenishing RbAp48 in the brains of mice, the researchers were able to undo existing age-related memory damage.

To find RbAp48, researchers focused on the hippocampus, the region of the brain where memories are formed. After studying eight healthy brains donated to science by people between the ages of 33 and 88, they found that RbAp48 was reduced by nearly 50 percent in the older brains. The researchers found that when they turned off RbAp48 in younger mice, they became more forgetful, while increasing RbAp48 in older mice restored memory. The mice were given memory tests that included object recognition and water maze problems.

  • Rasmussen HH. et al.,1992, Electrophoresis 13:960-9.
  • Qian Y.-W. et al., 1993,  Nature 364:648-52.
  • Yarden R.I. et al., 1999, Proc. Natl. Acad. Sci. USA. 96: 4983-8.
  • Ota T. et al., 2004, Nat. Genet. 36:40-45.
  • Gauci S. et al., 2009, Anal. Chem. 81:4493-501.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items