Quick Order

Human RNASET2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RNASET2cDNA Clone Product Information
cDNA Size:771
cDNA Description:ORF Clone of Homo sapiens ribonuclease T2 DNA.
Gene Synonym:RNASE6PL, bA514O12.3, RP11-514O12.3, RNASET2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

RNASET2 (ribonuclease T2) is an enzyme which belongs to the RNase T2 family. It is highly expressed in the temporal lobe and fetal brain. RNASET2 gene is a novel member of the Rh/T2/S-glycoprotein class of extracellular ribonucleases. It is a single copy gene that maps to 6q27, a region associated with human malignancies and chromosomal rearrangement. Defects in RNASET2 are the cause of leukoencephalopathy cystic without megalencephaly. An infantile-onset syndrome of cerebral leukoencephalopathy. Affected newborns develop microcephaly and neurologic abnormalities including psychomotor impairment, seizures and sensorineural hearing impairment. The brain shows multifocal white matter lesions, anterior temporal lobe subcortical cysts, pericystic abnormal myelination, ventriculomegaly and intracranial calcifications.

  • Acquati F, et al. (2011) A Molecular signature induced by RNASET2, a tumor antagonizing gene, in ovarian cancer cells. Oncotarget. 2(6):477-84.
  • Campomenosi P, et al. (2011) Comparison of the baculovirus-insect cell and Pichia pastoris heterologous systems for the expression of the human tumor suppressor protein RNASET2. Biotechnol Appl Biochem. 58(1):39-49.
  • Monti L, et al. (2008) RNASET2 as a tumor antagonizing gene in a melanoma cancer model. Oncol Res. 17(2):69-74.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items