After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human DCX Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DCXcDNA Clone Product Information
Gene_bank_ref_id:BC027925
cDNA Size:1083
cDNA Description:ORF Clone of Homo sapiens doublecortin DNA.
Gene Synonym:DC, DBCN, LISX, SCLH, XLIS, DCX
Species:Human
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
 
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

DCX (doublecortin, N-GST chimera)contains 2 doublecortin domains and belongs to the doublecortin family. It is highly expressed in neuronal cells of fetal brain, but not expressed in other fetal tissues. In the adult, it is highly expressed in the brain frontal lobe, but very low expression in other regions of brain, and not detected in heart, placenta, lung, liver, skeletal muscles, kidney and pancreas. DCX is a microtubule-associated protein required for initial steps of neuronal dispersion and cortex lamination during cerebral cortex development. It may act by competing with the putative neuronal protein kinase DCAMKL1 in binding to a target protein. DCX may in that way participate in a signaling pathway that is crucial for neuronal interaction before and during migration, possibly as part of a calcium ion-dependent signal transduction pathway. It may be part with LIS-1 of a overlapping, but distinct, signaling pathways that promote neuronal migration. Defects in DCX are the cause of lissencephaly X-linked type 1 and subcortical band heterotopia X-linked.

References
  • Des Portes V, et al. (1998) A novel CNS gene required for neuronal migration and involved in X-linked subcortical laminar heterotopia and lissencephaly syndrome. Cell. 92:51-61.
  • Gleeson J G, et al. (998) Doublecortin, a brain-specific gene mutated in human X-linked lissencephaly and double cortex syndrome, encodes a putative signaling protein. Cell. 92:63-72.
  • Ross M T, et al. (2005) The DNA sequence of the human X chromosome. Nature. 434:325-37.
  • Size / Price
    Catalog:HG13498-NF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"