Quick Order

Human ESM1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ESM1cDNA Clone Product Information
cDNA Size:555
cDNA Description:ORF Clone of Homo sapiens endothelial cell-specific molecule 1 DNA.
Gene Synonym:ESM1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

ESM1 is a secreted protein which is produced by adipocytes. It has been noticed that ESM1 may play some role in obesity-associated vascular disease since circulating ESM-1 levels are reduced in the overweight and obese. ESM1 is mainly expressed in the endothelial cells in human lung and kidney tissues. The expression of ESM1 gene is regulated by cytokines, suggesting that it may play a role in endothelium-dependent pathological disorders. Recently, ESM1 has been described as a specific biomarker of tip cells during neoangiogenesis. Its expression has been shown to be increase in presence of pro-angiogenic growth factors such as VEGF or FGF-2. In hypervascularized cancers, overexpression of endocan has been detected by immunohistochemistry using monoclonal antibodies against ESM1.

  • Cong R, et al. (2006) Hhex is a direct repressor of endothelial cell-specific molecule 1 (ESM-1). Biochem. Biophys Res Commun. 346(2):535-45.
  • Aitkenhead M, et al. (2002) Identification of endothelial cell genes expressed in an in vitro model of angiogenesis: induction of ESM-1, (beta)ig-h3, and NrCAM. Microvasc Res. 63(2): 159-71.
  • Lassalle P, et al. (1996) ESM-1 is a novel human endothelial cell-specific molecule expressed in lung and regulated by cytokines. J Biol Chem. 271(34):20458-64.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items