Quick Order

Text Size:AAA

Human CSNK1G1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CSNK1G1 cDNA Clone Product Information
Gene_bank_ref_id:NM_022048.3
RefSeq ORF Size:1269bp
cDNA Description:Full length Clone DNA of Homo sapiens casein kinase 1, gamma 1 with N terminal Myc tag.
Gene Synonym:CSNK1G1
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Casein kinase I isoform gamma-1, also known as CSNK1G1, is a member of the protein kinase superfamily, CK1 Ser/Thr protein kinase family and casein kinase I subfamily. The casein kinase I family of protein kinases are serine / threonine-selective enzymes that function as regulators of signal transduction pathways in most eukaryotic cell types. Casein has been used as a substrate since the earliest days of research on protein phosphorylation. Casein kinase activity associated with the endoplasmic reticulum of mammary glands was first characterized in 1974 and its activity was shown to not depend on cyclic AMP. The CKI family of monomeric serine–threonine protein kinases is found in eukaryotic organisms from yeast to human. Mammals have seven family members: alpha, beta 1, gamma 1, gamma 2, gamma 3, delta, and epsilon. The family members have the highest homology in their kinase domains (53%–98% identical) and differ from most other protein kinases by the presence of the sequence S-I-N instead of A-P-E in kinase domain VIII. The CKI family members appear to have similar substrate specificity and substrate selection is thought to be regulated via subcellular localization and docking sites in specific substrates.

References
  • E. Bingham. et al.,1974, Journal of Biological Chemistry. 249: 3647-51.
  • Wojciech S. et al., 2004,  Journal of Biological Chemistry.279: 13011-7.
  • L. Lum. et al., 2004, Science Volume 304, pages 1755-9.
  • R. Takada. et al., 2005, Genes Cells Volume 10: 919-28.
  • G. Davidson. et al., 2005, Nature Volume 438:  867-72.
  • Size / Price
    Catalog: HG11569-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"