Quick Order

Human CST1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CST1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001898.2
RefSeq ORF Size:426bp
cDNA Description:Full length Clone DNA of Homo sapiens cystatin SN with N terminal Myc tag.
Gene Synonym:CST1
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Cystatin-SN, also known as Cystain-SA-I, Cystatin-1, Salivary cystatin-SA-1 and CST1, is a secreted protein which belongs to the cystatin family. The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. Cystatin-SN / CST1 is expressed in submandibular and sublingual saliva but not in parotid saliva (at protein level). Cystatin-SN / CST1 is also expressed in saliva, tears, urine and seminal fluid. Human saliva appears to contain several cysteine proteinase inhibitors that are immunologically related to cystatin S but that differ in their specificity due to amino acid sequence differences. Human salivary cystatins include Cystatin-S, Cystatin-S1, Cystatin-S2, Cystatin- SA, Cystatin-SN, Cystatin-C and Cystatin-D. Cystatin-SN is a much better inhibitor of papain and dipeptidyl peptidase I than is cystatin-S, although both inhibit ficin equally well.

Size / Price
Catalog: HG11568-NM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"