Quick Order

Human TGFBI ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TGFBI cDNA Clone Product Information
Gene_bank_ref_id:NM_000358.2
RefSeq ORF Size:2052bp
cDNA Description:Full length Clone DNA of Homo sapiens transforming growth factor, beta-induced, 68kDa with C terminal His tag.
Gene Synonym:CSD, CDB1, CDG2, CSD1, CSD2, CSD3, EBMD, LCD1, BIGH3, CDGG1
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

TGFBI is an RGD-containing protein that binds to type I, II and IV collagens. The RGD motif is found in many extracellular matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. TGFBI plays a role in cell-collagen interactions and may be involved in endochondrial bone formation in cartilage. TGFBI is induced by transforming growth factor-beta and acts to inhibit cell adhesion. Mutations in TGFBI are associated with multiple types of corneal dystrophy. TGFBI can bind to type I, II, and IV collagens. This adhesion protein may play an important role in cell-collagen interactions. In cartilage, TGFBI may be involved in endochondral bone formation. Loss of the TGFBI is sufficient to induce specific resistance.

References
  • Kannabiran C, et al. (2006) TGFBI gene mutations in corneal dystrophies. Hum Mutat. 27(7): 615-25.
  • Size / Price
    Catalog: HG10569-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"