Quick Order

Human DDC ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DDC cDNA Clone Product Information
Gene_bank_ref_id:NM_000790.3
RefSeq ORF Size:1443bp
cDNA Description:Full length Clone DNA of Homo sapiens dopa decarboxylase (aromatic L-amino acid decarboxylase) with C terminal His tag.
Gene Synonym:AADC
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Dopa Decarboxylase (DDC), also known as AADC and Aromatic-L-amino acid decarboxylase, is a 54 kDa member of the group II decarboxylase family of proteins.It is a vitamin B6-dependent homodimeric enzyme that catalyzes the decarboxylation of both L-3,4-dihydroxyphenylalanine (L-DOPA) and L-5-hydroxytryptophan to dopamine and serotonin, respectively, which are major mammalian neurotransmitters and hormones belonging to catecholamines and indoleamines. Since L-DOPA is regularly used to treat the symptoms of Parkinson's disease, the catalytic pathway is of particular research interest. Defects of DDC are associated with severe developmental delay, oculogyric crises (OGC), as well as autosomal recessive disorder AADC deficiency, an early onset inborn error in neurotransmitter metabolism which can lead to catecholamine and serotonin deficiency.

References
  • Ichinose, H. et al.,1989,Biochem. Biophys. Res. Commun. 164: 1024-1030.
  • Lisa, J. S. et al., 1992, Genomics 13: 469-471.
  • Moore, P. S. et al.,1996, Biochem. J. 315:249-256.
  • Bertoldi, M. et al., 2003, Biochim. Biophys. Acta. 1647:42-47.
  • Vassilacopoulou, D. et al., 2004, Neurochem. Res. 29: 1817-1823.
  • Ma, J.Z., et al., 2005, Hum. Mol. Genet. 14: 1691-1698.
  • Size / Price
    Catalog: HG10560-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"