After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLEC4McDNA Clone Product Information
Gene_bank_ref_id:NM_014257.3
cDNA Size:1200
cDNA Description:ORF Clone of Homo sapiens C-type lectin domain family 4, member M DNA.
Gene Synonym:CD299, LSIGN, CD209L, L-SIGN, DCSIGNR, HP10347, DC-SIGN2, DC-SIGNR, MGC47866, MGC129964
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10559-ACG$325
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10559-ACR$325
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10559-CF$295
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10559-CH$295
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10559-CM$295
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10559-CY$295
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone)HG10559-M$95
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10559-M-F$295
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10559-M-N$295
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10559-NF$295
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10559-NH$295
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10559-NM$295
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10559-NY$295
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10559-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

C-type lectin domain family 4, member M, also known as DC-SIGNR and CLEC4M, is a type II integral membrane protein that is 77% amino acid identical to DC-SIGN, an HIV gp120-binding protein. Though the encoded gene located in the same chromosome, DC-SIGN is expressed solely on dendritic cells, while DC-SIGNR is predominantly found in liver sinusoidal endothelial cells and lymph node, as well as placental endothelium. DC-SIGNR exists as a homotetramer, and the tandem repeat domain, also called neck domain, mediates oligermerization. DC-SIGNR is ragarded as a pathogen-recognition receptor involved in peripheral immune surveillance in liver, and probably mediate the endocytosis of pathogens which are subsequently degraded in lysosomal compartments. DC-SIGNR appears to selectively recognize and bind many viral surface glycoproteins containing high mannose N-linked oligosaccharides in a calcium-dependent manner, including HIV-1 gp120, HIV-2 gp120, SIV gp120, ebolavirus glycoproteins, HCV E2, and human SARS coronavirus protein S, as well as the cellular adhesion protein ICAM3. DC-SIGNR have been thought to play an important role in establishing HIV infection by enhancing trans-infection of CD4(+)T cells in the regional lymph nodes. It may affect susceptibility to HIV infection by a mechanism that is different in females and males. DC-SIGNR can bind to hepatitis C virus (HCV), and its polymorphism might affect HCV loads supporting the concept that DC-SIGNR contributes to HCV replication efficacy.

References
  • Nattermann J, et al. (2006) The tandem-repeat polymorphism of the DC-SIGNR gene in HCV infection. J Viral Hepat. 13(1): 42-6.
  • Wichukchinda N, et al. (2007) The polymorphisms in DC-SIGNR affect susceptibility to HIV type 1 infection. AIDS Res Hum Retroviruses. 23(5): 686-92.
  • Size / Price
    Catalog:HG10559-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"