Quick Order

Text Size:AAA

Human NCKIPSD Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NCKIPSDcDNA Clone Product Information
cDNA Size:2148
cDNA Description:ORF Clone of Homo sapiens NCK interacting protein with SH3 domain DNA.
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human NCKIPSD Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Related Products
Product nameProduct name

NCKIPSD is localized exclusively in the cell nucleus. It plays a role in signal transduction, and may function in the maintenance of sarcomeres and in the assembly of myofibrils into sarcomeres. NCKIPSD also plays an important role in stress fiber formation. NCKIPSD gene is involved in therapy-related leukemia by a chromosomal translocation t(3;11)(p21;q23) that involves this gene and the myeloid/lymphoid leukemia gene. Alternative splicing occurs in this locus and two transcript variants encoding distinct isoforms have been identified. NCKIPSD is a SH3 domain protein. Fas ligand is a cytotoxic effector molecule of T and NK cells which is characterized by an intracellular N-terminal polyproline region that serves as a docking site for SH3 and WW domain proteins. Several previously described Fas ligand-interacting SH3 domain proteins turned out to be crucial for the regulation of storage, expression and function of the death factor. Recent observations, however, indicate that Fas ligand is also subject to posttranslational modifications including shedding and intramembrane proteolysis.

  • Satoh, S, et al. (2001) mDia-interacting protein acts downstream of Rho-mDia and modifies Src activation and stress fiber formation. J Biol Chem. 276(42):39290-4.
  • de Bernard M, et al. (2000) The VacA toxin of Helicobacter pylori identifies a new intermediate filament-interacting protein. EMBO J. 19(1):48-56.
  • Sano K, et al. (2000) Novel SH3 protein encoded by the AF3p21 gene is fused to the mixed lineage leukemia protein in a therapy-related leukemia with t(3;11) (p21;q23). Blood. 95(3): 1066-8.
  • Voss M, et al. (2009) Identification of SH3 domain interaction partners of human FasL (CD178) by phage display screening. BMC Immunol. 10:53.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items