Quick Order

Human ACY1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ACY1 cDNA Clone Product Information
Gene_bank_ref_id:NM_000666.1
RefSeq ORF Size:1227bp
cDNA Description:Full length Clone DNA of Homo sapiens aminoacylase 1 with C terminal His tag.
Gene Synonym:ACY1D, ACYLASE
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Aminoacylase 1 (ACY1), a metalloenzyme that removes amide-linked ACY1 groups from amino acids and may play a role in regulating responses to oxidative stress. Both the C-terminal fragment found in the two-hybrid screen and full-length ACY1 co-immunoprecipitate with SphK1. Though both C-terminal and full-length proteins slightly reduce SphK1 activity measured in vitro, the C-terminal fragment inhibits while full-length ACY1 potentiates the effects of SphK1 on proliferation and apoptosis. It suggested that ACY1 physically interacts with SphK1 and may influence its physiological functions. As a homodimeric zinc-binding enzyme, Aminoacylase 1 catalyzes the hydrolysis of N alpha-acylated amino acids. Deficiency of Aminoacylase 1 due to mutations in the Aminoacylase 1 (ACY1) gene follows an autosomal-recessive trait of inheritance and is characterized by accumulation of N-acetyl amino acids in the urine.

References
  • Sommer A, et al. (2011) The molecular basis of aminoacylase 1 deficiency. Biochim Biophys Acta. 1812(6): 685-90.
  • Maceyka M, et al. (2004) Aminoacylase 1 is a sphingosine kinase 1-interacting protein. FEBS Lett. 568(1-3): 30-4.
  • Cook RM, et al.(1993) Human aminoacylase-1. Cloning, sequence, and expression analysis of a chromosome 3p21 gene inactivated in small cell lung cancer. J Biol Chem. 268(23): 17010-7.
  • Size / Price
    Catalog: HG10549-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"