Quick Order

Human DBH ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DBH cDNA Clone Product Information
Gene_bank_ref_id:BC017174
RefSeq ORF Size:1812bp
cDNA Description:Full length Clone DNA of Homo sapiens dopamine beta-hydroxylase (dopamine beta-monooxyge) with N terminal Flag tag.
Gene Synonym:DBM, DBH
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

DBH is a 290 kDa copper-containing oxygenase. It can be detected in noradrenergic nerve terminals of the central and peripheral nervous systems, and is also expressed in chromaffin cells of the adrenal medulla. DBH contains our identical subunits, and its activity requires ascorbate as a cofactor. It functions in in the synthesis of small-molecule neurotransmitters that is membrane-bound, making norepinephrine the only transmitter synthesized inside vesicles. DBH has been shown to be associated with decision making and addictive behaviors such as alcohol and smoking, attention deficit hyperactivity disorder, and also with neurological diseases such as Schizophrenia and Alzheimer's.

References
  • Rush RA. et al., 1980, Crit Rev Clin Lab Sci. 12 (3): 241-77.
  • Goldstein M. et al., 1964, Life Sci. 3 (7): 763-7.
  • S Friedman. et al., 1966, The Journal of Biological Chemistry. 241 (10): 2256-9.
  • Size / Price
    Catalog: HG13440-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"