Quick Order

Human MMP-1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MMP1cDNA Clone Product Information
Gene_bank_ref_id:NM_002421.3
cDNA Size:1410
cDNA Description:ORF Clone of Homo sapiens matrix metallopeptidase 1 (interstitial collagenase) DNA.
Gene Synonym:CLG, CLGN
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

MMP1, also known as MMP-1, contains 4 hemopexin-like domains and is a member of the matrix metalloproteinase (MMP) family. Matrix metalloproteases, also called matrixins, are zinc-dependent endopeptidases that are the major proteases involved in ECM degradation. MMPs are capable of degrading a wide range of extracellular molecules and a number of bioactive molecules. MMP activity is regulated by two major endogenous inhibitors: alpha2-macroglobulin and tissue inhibitors of metalloproteases (TIMPs). MMPs play a central role in cell proliferation, migration, differentiation, angiogenesis, apoptosis and host defences. Dysregulatoin of MMPs has been implicated in many diseases including arthritis, chronic ulcers, encephalomyelitis and cancer. Tumour metastasis is a multistep process involving the dessemination of tumor cells from the primary tumor to secondarys at a distant organ or tissue. One of the first steps in metastasis is the degradation of the basement membrane, a process in which MMPs have been implicated. MMPs are secreted by tumor cells themselves or by surrounding stromal cells stimulated by the nearby tumor. Numerous studies have linked altered MMP expression in different human cancers with poor disease prognosis. MMP-1, -2, -3, -7, -9, -13 and -14 all have elevated expression in primary tumors and/or metastases. MMP-1 cleaves collagens of types I, II, and III at one site in the helical domain. It also cleaves collagens of types VII and X. In case of HIV infection, MMP1 interacts and cleaves the secreted viral Tat protein, leading to a decrease in neuronal Tat's mediated neurotoxicity.

References
  • Gross J, et al. (1962) Collagenolytic Activity in Amphibian Tissues: A Tissue Culture Assay. Proceedings of the National Academy of Sciences. 48(6):1014-22.
  • Pendas, et al. (1996) Fine Physical Mapping of the Human Matrix Metalloproteinase Genes Clustered on Chromosome 11q22.3. Genomics. 37(2):266-8.
  • Brinckerhoff C E, et al. (1987) Molecular cloning of human synovial cell collagenase and selection of a single gene from genomic DNA. Journal of Clinical Investigation. 79(2):542-6.
  • Size / Price
    Catalog:HG10532-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"