Quick Order

Human KNG1 / BDK transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
KNG1cDNA Clone Product Information
cDNA Size:1935
cDNA Description:ORF Clone of Homo sapiens kininogen 1, transcript variant 1 DNA.
Gene Synonym:BDK, KNG
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human KNG1 / BDK transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Human KNG1 / BDK transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10529-ACG$345
Human KNG1 / BDK transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10529-ACR$345
Human KNG1 / BDK transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10529-CF$315
Human KNG1 / BDK transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10529-CH$315
Human KNG1 / BDK transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10529-CM$315
Human KNG1 / BDK transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10529-CY$315
Human KNG1 / BDK transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10529-M$115
Human KNG1 / BDK transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10529-M-F$315
Human KNG1 / BDK transcript variant 1 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10529-M-N$315
Human KNG1 / BDK transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10529-NF$315
Human KNG1 / BDK transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10529-NH$315
Human KNG1 / BDK transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10529-NM$315
Human KNG1 / BDK transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10529-NY$315
Human KNG1 / BDK transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10529-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Mouse kininogen-1, also known as high molecular weight kininogen, williams-Fitzgerald-Flaujeac factor, Alpha-2-thiol proteinase inhibitor, Fitzgerald factor, KNG1 and BDK, is a secreted protein which contains three cystatin domains. Kininogen-1 / KNG1 is a protein from the blood coagulation system as well as the kinin-kallikrein system. It is a protein that adsorbs to the surface of biomaterials that come in contact with blood. Kininogen-1 / KNG1 circulates throughout the blood and quickly adsorbs to the material surfaces. Kininogen-1 / KNG1 is one of the early participants of the intrinsic pathway of coagulation, together with Factor XII (Hageman factor) and prekallikrein. Kininogen-1 / KNG1 is one of the kininogens, a class of proteins. As with many other coagulation proteins, the protein was initially named after the patients in whom deficiency was first observed. When the clinical data were combined, it turned out that all patients, in fact, had a deficiency of the same protein. Defects in KNG1 are the cause of high molecular weight kininogen deficiency (HMWK deficiency) which is an autosomal recessive coagulation defect. Patients with HWMK deficiency do not have a hemorrhagic tendency, but they exhibit abnormal surface-mediated activation of fibrinolysis.

Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items