Quick Order

Text Size:AAA

Human LBP ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LBP cDNA Clone Product Information
NCBI RefSeq:NM_004139.2
RefSeq ORF Size:1446bp
cDNA Description:Full length Clone DNA of Homo sapiens lipopolysaccharide binding protein with C terminal His tag.
Gene Synonym:MGC22233
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Lipopolysaccharide binding protein ( LBP ) is a glycoprotein that is synthesized principally by hepatocytes. LBP is a trace plasma protein that binds to the lipid A moiety of bacterial lipopolysaccharides ( LPSs ). LBP binds directly to the outer membrane of Gram-negative bacteria and to purified aggregates of extracted endotoxin, and catalyses the delivery of endotoxin to membrane ( mCD14,GPI-Linked ) and soluble ( sCD14 ) forms of CD14, thereby markedly increasing host cell sensitivity to endotoxin. LBP efficiently catalyses the transfer of individual molecules of endotoxin to (s)CD14 only when LBP–endotoxin aggregates are formed in the presence of albumin. In the presence of EDTA, LBP binding promotes further disaggregation of endotoxin. LBP binding does not have such drastic effects under more physiological conditions, but may still induce more subtle topological rearrangements of endotoxin.

References
  • J. Weiss, 2003, Biochemical Society Transactions: Volume 31, part 4: 785-790.
  • RR Schumann, et al., Science, 1990, Vol 249, Issue 4975: 1429-143.
  • Carsten J. Kirschning, et al., 1997, Genomics, Volume 46, Issue 3: 416-25.
  • Size / Price
    Catalog: HG10526-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"