Quick Order

Cynomolgus monkey ENSA Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ENSAcDNA Clone Product Information
Gene_bank_ref_id:XM_005541982.1
cDNA Size:366
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) endosulfine alpha DNA.
Gene Synonym:ENSA
Species:Cynomolgus
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
 
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Cynomolgus monkey ENSA Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Cynomolgus monkey ENSA Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90656-ACG$325
Cynomolgus monkey ENSA Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90656-ACR$325
Cynomolgus monkey ENSA Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90656-ANG$325
Cynomolgus monkey ENSA Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90656-ANR$325
Cynomolgus monkey ENSA Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90656-CF$295
Cynomolgus monkey ENSA Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90656-CH$295
Cynomolgus monkey ENSA Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90656-CM$295
Cynomolgus monkey ENSA Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90656-CY$295
Cynomolgus monkey ENSA Gene cDNA Clone (full-length ORF Clone)CG90656-G$95
Cynomolgus monkey ENSA Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90656-NF$295
Cynomolgus monkey ENSA Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90656-NH$295
Cynomolgus monkey ENSA Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90656-NM$295
Cynomolgus monkey ENSA Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90656-NY$295
Cynomolgus monkey ENSA Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90656-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Endosulfine alpha, also known as ENSA, belongs to the endosulfine family. It is a highly conserved cAMP-regulated phosphoprotein (ARPP) family. Endosulfine alpha is widely expressed with high levels in skeletal muscle and brain and lower levels in the pancreas. As a protein phosphatase inhibitor, ENSA specifically inhibits protein phosphatase 2A (PP2A) during mitosis. When phosphorylated at Ser-67 during mitosis, specifically interacts with PPP2R2D (PR55-delta) and inhibits its activity, leading to inactivation of PP2A, an essential condition to keep cyclin-B1-CDK1 activity high during M phase By similarity. Endosulfine alpha also acts as a stimulator of insulin secretion by interacting with sulfonylurea receptor (ABCC8), thereby preventing sulfonylurea from binding to its receptor and reducing K(ATP) channel currents.

References
  • Ye M. et al., 2001, Genome Res. 10 (10): 1546-60.
  • Apiou F. et al., 1999, Diabetes 48 (9): 1873-6.
  • Lennon G. et al., 1997, Genome Res. 6 (9): 791-806.
  • Size / Price
    Catalog:CG90656-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"