After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human Tie1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TIE1 cDNA Clone Product Information
Gene_bank_ref_id:NM_005424.2
RefSeq ORF Size:3417bp
cDNA Description:Full length Clone DNA of Homo sapiens tyrosine kinase with immunoglobulin-like and EGF-like domains 1 with C terminal His tag.
Gene Synonym:TIE, JTK14
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Background

Tyrosine kinase with immunoglobulin-like and EGF-like domains 1 also known as Tie1 is an angiopoietin receptor and is an orphan receptor tyrosine kinase that is expressed almost exclusively in endothelial cells and that is required for normal embryonic vascular development. The receptor tyrosine kinase Tie1 is expressed primarily in vascular endothelial cells. The receptor has also been detected in epithelial tumours in breast, thyroid and gastric cancers and in tumour cell lines where it appears as a 45 kDa truncated receptor fragment. Tie1 promotes endothelial cell survival, but other studies have suggested that the Tie1 kinase has little to no activity. Embryos deficient in Tie1 failed to establish structural integrity of vascular endothelial cells, resulting in oedema and subsequently localized haemorrhage. Tie1 is significantly higher in human aortic endothelial cells than in human umbilical vein endothelial cells. Additionally, attachment of cells of monocytic lineage to endothelial cells is also enhanced by Tie1 expression. Collectively Tie1 has a proinflammatory property and may play a role in the endothelial inflammatory diseases such as atherosclerosis.

References
  • Chan B, et al. (2008) Receptor tyrosine kinase Tie-1 overexpression in endothelial cells upregulates adhesion molecules. Biochem Biophys Res Commun. 371(3): 475-9.
  • Sato TN, et al. (1995) Distinct roles of the receptor tyrosine kinases Tie-1 and Tie-2 in blood vessel formation. Nature. 376(6535): 70-4.
  • Rees KA, et al. (2007) The receptor tyrosine kinase Tie1 is expressed and activated in epithelial tumour cell lines. Int J Oncol. 31(4): 893-7.
  • Kontos CD, et al. (2002) The endothelial receptor tyrosine kinase Tie1 activates phosphatidylinositol 3-kinase and Akt to inhibit apoptosis. Mol Cell Biol. 22(6): 1704-13.
  • Size / Price
    Catalog: HG10509-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"