After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CCL20 transcript variant 2 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CCL20 cDNA Clone Product Information
Gene_bank_ref_id:NM_001130046.1
RefSeq ORF Size:288bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 20, transcript variant 2 with C terminal His tag.
Gene Synonym:CKb4, LARC, ST38, MIP3A, MIP-3a, SCYA20, CCL20
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-CCL20-His
Restriction Site:KpnI + XbaI (6kb + 0.34kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Background

Chemokine (C-C motif) ligand 20 (CCL20) or liver activation regulated chemokine (LARC) or Macrophage Inflammatory Protein-3 (MIP3A) is a small cytokine belonging to the CC chemokine family that attracts immature dendritic cells and memory T lymphocytes, both expressing CCR6. Depending on the cell type, this chemokine was found to be inducible by cytokines (IL-1beta) and by bacterial, viral, or plant products (including LPS, dsRNA, and PMA). MIP3A / CCL20 is Expressed predominantly in the liver, lymph nodes, appendix, peripheral blood lymphocytes, and fetal lung. Low levels of MIP3A / CCL20 has been seen in thymus, prostate, testis, small intestine and colon. As a chemotactic factor, MIP3A / CCL20 attracts lymphocytes and, slightly, neutrophils, but not monocytes. This chemokine may Inhibit proliferation of myeloid progenitors in colony formation assays and it may be involved in formation and function of the mucosal lymphoid tissues by attracting lymphocytes and dendritic cells towards epithelial cells. Its C-terminal processed forms have been shown to be equally chemotactically active for leukocytes. Chemokine CCL20 was shown to play a role in colorectal cancer (CRC) pathogenesis.

References
  • Vicinus B, et al. (2012) miR-21 functionally interacts with the 3'UTR of chemokine CCL20 and down-regulates CCL20 expression in miR-21 transfected colorectal cancer cells. Cancer Lett. 316(1): 105-12.
  • Ding X, et al. (2012) High Expression of CCL20 Is Associated with Poor Prognosis in Patients with Hepatocellular Carcinoma after Curative Resection. J Gastrointest Surg. 16(4): 828-36.
  • Ivison SM, et al. (2010) Oxidative stress enhances IL-8 and inhibits CCL20 production from intestinal epithelial cells in response to bacterial flagellin. Am J Physiol Gastrointest Liver Physiol. 299(3): 733-41.
  • Size / Price
    Catalog: HG10485-CH
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"