Quick Order

Human CTSB Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CTSBcDNA Clone Product Information
cDNA Size:1020
cDNA Description:ORF Clone of Homo sapiens cathepsin B DNA.
Gene Synonym:APPS, CPSB, CTSB
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Cathepsin B is a papain-family cysteine protease that is normally located in lysosomes, where it is involved in the turnover of proteins and plays various roles in maintaining the normal metabolism of cells. This protease has been implicated in pathological conditions, e.g., tumor progression and arthritis. In disease conditions, increases in the expression of cathepsin B occur at both the gene and protein levels. Cathepsin B is synthesized as a preproenzyme and the primary pathways for its normal trafficking to the lysosome utilize mannose 6-phosphate receptors (MPRs). Mature cathepsin B has the ability to degrade several extracellular matrix components at both neutral and acidic pH and has been implicated in the progression of several human and rodent tumors progression and arthritis. Cathepsin B expression is increased in many human cancers at the mRNA, protein and activity levels. It is also frequently overexpressed in premalignant lesions, an observation that associates this protease with local invasive stages of cancer. Increased expression of cathepsin B in primary cancers, and especially in preneoplastic lesions, suggests that this enzyme might have pro-apoptotic features. Active cathepsin B is also secreted from tumours, a mechanism likely to be facilitated by lysosomal exocytosis or extracellular processing by surface activators. Cathepsin B is localized to caveolae on the tumour surface, where binding to the annexin II heterotetramer occurs. Thus CTSB is suggested as a tumor marker. Additionally, Cathepsin B can degrade extracellular matrix proteins, such as collagen IV and laminin, and can activate the precursor form of urokinase plasminogen activator (uPA), perhaps thereby initiating an extracellular proteolytic cascade.

  • Mai J, et al. (2000) Cell surface complex of cathepsin B/annexin II tetramer in malignant progression. Biochim Biophys Acta. 1477(1-2): 215-30.
  • Podgorski I, et al. (2003) Cathepsin B and its role(s) in cancer progression. Biochem Soc Symp. (70): 263-76.
  • Yan S, et al. (2003) Molecular regulation of human cathepsin B: implication in pathologies. Biol Chem. 384(6): 845-54.
  • Roshy S, et al. (2003) Pericellular cathepsin B and malignant progression. Cancer Metastasis Rev. 22(2-3): 271-86.

    Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items