Quick Order

Human PNLIPRP1 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PNLIPRP1 cDNA Clone Product Information
Gene_bank_ref_id:BC025784
RefSeq ORF Size:1404bp
cDNA Description:Full length Clone DNA of Homo sapiens pancreatic lipase-related protein 1 with C terminal Myc tag.
Gene Synonym:PLRP1, PNLIPRP1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

PNLIPRP1, also known as PLRP1, belongs to the AB hydrolase superfamily, Lipase family. PNLIPRP1 is structurally similar to PLRP2. However, these two proteins display different functional properties. PNLIPRP1 may function as inhibitor of dietary triglyceride digestion. It lacks detectable lipase activity towards triglycerides, diglycerides, phosphatidylcholine, galactolipids or cholesterol esters. PLRP2 hydrolyses milk fat with a lower catalytic efficiency than that of PL. PLRP2 activity, higher on homogenized than on native milk fat, is differently influenced by fatty acids and colipase depending on a proteolytic cleavage in the lid domain.

References
  • Grupe A. et al., 2006, Am J Hum Genet. 78 (1): 78-88.
  • Strausberg RL. et al., 2002, Proc Natl Acad Sci. 99 (26): 16899-903.
  • Giller T. et al., 1992, J Biol Chem. 267 (23): 16509-16.
  • Size / Price
    Catalog: HG13565-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"