Quick Order

Text Size:AAA

Human CCL14 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CCL14 cDNA Clone Product Information
Gene_bank_ref_id:NM_032963.2
RefSeq ORF Size:282bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 14 with C terminal His tag.
Gene Synonym:CC-1, CC-3, CKb1, MCIF, NCC2, SY14, HCC-1, HCC-3, NCC-2, SCYL2, SCYA14, CCL14
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

References
  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28(5): 443-60.
  • Knappe S, et al. (1996) HCC-1, a novel chemokine from human plasma. J Exp Med. 183: 295-9.
  • Naruse, et al. (1996) A YAC contig of the human CC chemokine genes clustered on chromosome 17q11.2. Genomics. 34: 236-40.
  •  

    CCL14/HCC-1/HCC-3 related areas, pathways, and other information

    Size / Price
    Catalog: HG10476-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"