After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human FKBP7 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FKBP7cDNA Clone Product Information
cDNA Size:669
cDNA Description:ORF Clone of Homo sapiens FK506 binding protein 7 DNA.
Gene Synonym:FKBP23, PPIase, FKBP7
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

PPIase is a member of the immunophilin protein family. It also belongs to the cyclophilin-type PPIase family, PPIL3 subfamily. PPIase contains 1 PPIase cyclophilin-type domain. Members of the immunophilin protein family play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. It has a very high substrate specificity for the four-residue peptide Ala-Ala-Pro-Phe only when the proline peptide bond is in the trans state. It interacts with several intracellular signal transduction proteins including type I TGF-beta receptor. It also interacts with multiple intracellular calcium release channels, and coordinates multi-protein complex formation of the tetrameric skeletal muscle ryanodine receptor. In mouse, deletion of this homologous gene causes congenital heart disorder known as noncompaction of left ventricular myocardium.

  • 1. Shor B, et al. (2008) A new pharmacologic action of CCI-779 involves FKBP12-independent inhibition of mTOR kinase activity and profound repression of global protein synthesis. Cancer Res. 68(8):2934-43.
  • 2. Talmud PJ, et al. (2009) Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip. Am J Hum Genet. 85(5):628-42.
  • 3. Deleersnijder A, et al. (2011) Comparative analysis of different peptidyl-prolyl isomerases reveals FK506-binding protein 12 as the most potent enhancer of alpha-synuclein aggregation. J Biol Chem. 286(30):26687-701.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks